Query Matrix family_2_cluster_2Consensus: TGAAACA, Length: 7 | ![]() |
| Number of instances | Instance with highest total number of occurences | Instance with highest occurence in one sequence | Instance with highest z-score (Trawler) |
|---|---|---|---|
| 24 | TRAAACR occurs 82 times in 38 sequences | 8 times for TGNAACA in iYGRWdelta19 | z-score= 7.4281235 for TGMMACA |
| Name | Source DB | ID, Link to Source | Length | Orientation | Offset | Divergence | Overlap | Consensus |
|---|---|---|---|---|---|---|---|---|
| NRSF | TRANSFAC | M00256 | 21 | reverse-complement | -17 | 0.455 | 4 | TTCAGCACCACGGACAGCGCC |
| JASPAR | MA0069 | 14 | reverse-complement | -10 | 0.618 | 4 | TTCACGCWTGANTT | |
| MAT1MC | TRANSFAC | M00276 | 10 | reverse-complement | 2 | 0.682 | 5 | TCNATTGTTT |
| Sox-5 | JASPAR | MA0087 | 7 | as given | 2 | 0.709 | 5 | NAACAAT |
| ATHB1 | TRANSFAC | M00089 | 14 | as given | -10 | 0.730 | 4 | NTNCAATTATTGCA |
| SEF1 | TRANSFAC | M00214 | 19 | as given | 3 | 0.794 | 4 | AACACGGATATCTGTGGTY |
| SOX-9 | JASPAR | MA0077 | 9 | as given | 2 | 0.801 | 5 | NAACAATRG |
Query Matrix family_1_cluster_1Consensus: NAGAATGN, Length: 8 | ![]() |
| Number of instances | Instance with highest total number of occurences | Instance with highest occurence in one sequence | Instance with highest z-score (Trawler) |
|---|---|---|---|
| 18 | RGAATK occurs 171 times in 50 sequences | 11 times for RGAATK in iYDL128W | z-score= 7.768136 for RRGAATG |
| Name | Source DB | ID, Link to Source | Length | Orientation | Offset | Divergence | Overlap | Consensus |
|---|---|---|---|---|---|---|---|---|
| ABAA | TRANSFAC | M00027 | 19 | reverse-complement | -5 | 0.563 | 8 | NNNNYTNCATTCCNNNNNN |
| STAT | TRANSFAC | M00223 | 9 | reverse-complement | -4 | 0.677 | 5 | TTCCCGGAA |
| STAT | TRANSFAC | M00223 | 9 | as given | -4 | 0.683 | 5 | TTCCCGGAA |
| HSF | TRANSFAC | M00170 | 15 | as given | -9 | 0.879 | 6 | NTTCTAGAANAGAAN |